rs15754 chr20:58894172 C>G
- Sequence
aatgatcttaaaataatttttcag[C/G]cacatttcataaatgtggaaactg
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.16 | 0.58 | 2.00 | |||
| GM12878 (female B-cells) | 0.25 | 0.68 | 1.38 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid