rs1582218 chr6:82006558 G>A
- Sequence
ataattacaaaaattagaagtgcc[G/A]gtgtctccagatgagaaggaatca
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.08 | 0.58 | 1.88 | |||
| foreskin keratinocyte | 1.53 | -0.49 | 2.00 |
Items per page:
1 – 2 of 2