rs158346 chr5:56326406 C>T
- Sequence
gagcagattgcccctcaaaacctc[C/T]cagaggctgaatggccctgctgtg
- ASB in cell types
- CLB-Ga (neuroblastoma)
- ASB for transcription factors
- HAND2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HAND2_HUMAN | 1.78 | n/a | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, diastolic blood pressure (dbp), ldl cholesterol, obesity with early age of onset (age >2), refractive error, rheumatoid arthritis, systolic blood pressure (sbp), total cholesterol, transmission distortion