rs158622 chr5:36887793 T>C
- Sequence
ttctgagccagatccagctgtcta[T/C]caggtacctcctgatgtcccatga
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.95 | -0.58 | 2.89 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, bipolar disorder, body mass index (bmi), height, hip bone mineral density (bmd), longstanding arthritis, rheumatoid arthritis, waist hip ratio, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_EBV-transformed_lymphocytes, Esophagus_Gastroesophageal_Junction, Lung, Muscle_Skeletal, Nerve_Tibial, Spleen, Testis, Whole_Blood