rs160939 chr5:56201160 C>T
- Sequence
gcattcctctaattccctctctcc[C/T]cctgcgggattatcctgaatgctt
- ASB in cell types
- HeLa Kyoto (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa Kyoto (cervical adenocarcinoma) | 0.95 | -0.49 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, ldl cholesterol, neuroblastoma (brain cancer), rheumatoid arthritis, schizophrenia, total cholesterol, triglycerides