rs1622100 chr12:104578501 A>C
- Sequence
ctttatctttctggttgcattttc[A/C]gaaccccctgcctctattgtgatg
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.87 | -0.12 | 2.01 | |||
| GM12878 (female B-cells) | 0.82 | -0.39 | 1.33 |
Items per page:
1 – 2 of 2