rs1623027 chr2:23503367 C>T
- Sequence
tcactaaggtcacttgtagcctga[C/T]cttccatggctctataattctctt
- ASB in cell types
- liver
- ASB for transcription factors
- COT2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT2_HUMAN | 1.70 | n/a | 1.33 | -3.12 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
