rs1641482 chr2:65567514 C>T
- Sequence
cagagagagggagcctcggccggg[C/T]gcggtggctcacgcctgtaatccc
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- SP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SP2_HUMAN | 1.69 | -1.72 | 1.33 | 2.33 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
