rs164632 chr19:4139852 C>T
- Sequence
gaggtgggagccatagaagatttc[C/T]ggcagaggagggacaggctctgac
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma) neutrophils
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.16 | -0.25 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.26 | 1.27 | 1.85 | |||
| HepG2 (hepatoblastoma) | 0.62 | 0.37 | 1.28 | |||
| neutrophils | 1.67 | -0.38 | 1.50 | |||
| GM12878 (female B-cells) | 1.41 | n/a | 1.33 |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, hdl cholesterol, microalbuminuria, mitral annular calcium, primary rhegmatogenous retinal detachment, simpson-angus scale, total cholesterol, triglycerides change with statins, variant creutzfeldt-jakob disease