rs1646332 chr16:13955870 C>A
- Sequence
ctagagaaggacttgatttggaaa[C/A]ggagaagtacagttttgatgggaa
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) monocyte-derived macrophages GM12878 (female B-cells)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -1.08 | 1.78 | 2.50 | 3.17 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
