rs16476 chr7:24290600 T>G
- Sequence
aatggccagccagcatgaagggtg[T/G]tagtatagagttgtgagatttgtt
- ASB in cell types
- foreskin keratinocyte VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -0.45 | 1.73 | 2.50 | |||
| VCaP (prostate carcinoma) | 2.10 | -2.84 | 2.00 |
Items per page:
1 – 2 of 2