rs1655662 chr3:10739057 T>A
- Sequence
cttccggtgccagctctgcagtga[T/A]ggcgccccctggtgtccaatgaaa
- ASB in cell types
- erythroid cells BCBL-1 (B-cell lymphoma) T47D (invasive ductal carcinoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | n/a | 3.67 | 2.00 | |||
| BCBL-1 (B-cell lymphoma) | 2.69 | -3.42 | 1.50 | |||
| T47D (invasive ductal carcinoma) | 1.35 | -0.79 | 2.17 | |||
| foreskin keratinocyte | n/a | 0.22 | 2.33 | |||
| VCaP (prostate carcinoma) | -0.19 | 0.99 | 1.28 |
Items per page:
1 – 5 of 5