rs1656313 chr2:2860438 T>G
- Sequence
tgaacatgtgatcatgtggtagag[T/G]gaacgtgtaatgaacacatgataa
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells)
- ASB for transcription factors
- MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | 1.86 | 0.15 | 1.56 | n/a | n/a |
Items per page:
1 – 1 of 1