rs16585 chr17:33049262 C>T
- Sequence
atatttgggagtagcatggtgtgg[C/T]taaaagacttagctgtgtgccaaa
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -0.23 | 1.03 | 1.42 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hypertension (early onset hypertension), nausea in response to topiramate treatment in healthy volunteers, prop taste detection threshold, stabilized warfarin dose