rs166040 chr5:141831188 A>G
- Sequence
ctgtctgaccatgacactgacatc[A/G]gggagttcttcaccttctagatct
- ASB in cell types
- breast tumor tissue
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | n/a | 2.56 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, antidepressant efficacy in major depressive disorder improvement after 2 weeks of treatment, antidepressant efficacy in major depressive disorder partial response after 2 weeks of treatment, hdl cholesterol, maternal transmission distortion, parkinsons disease, total cholesterol, transmission distortion