rs167769 chr12:57109992 C>T
- Sequence
aaatggagaggtcccttctctgga[C/T]gtttctgctccaagaccttcatgc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.50 | -0.20 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, asthma (childhood asthma), atopic dermatitis, fasting blood glucose, homa-ir, ige in plasma, microalbuminuria, partial epilepsy, pediatric eosinophilic esophagitis, primary rhegmatogenous retinal detachment, rheumatoid arthritis, total serum ige, urinary albumin-to-creatinine ratio
PheWAS abnormal mammogram, acne, acute bronchitis and bronchiolitis, acute periodontitis, acute reaction to stress, acute upper respiratory infections, adverse effects of antibacterials (not penicillins), alcoholism, anomalies of pupillary function, aplastic anemia, benign neoplasm of lip, oral cavity, and pharynx, cancer of the digestive organs and peritoneum, cardiac arrhythmia nos, cardiac shunt/ heart septal defect, carditis, cirrhosis of liver without mention of alcohol, diseases of sebaceous glands, diseases of the jaws, disorders of diaphragm, disorders of muscle, ligament, and fascia, disturbance of skin sensation, disturbances of sensation of smell and taste, elevated blood pressure reading, endometriosis, eustachian tube disorders, fasciitis, graves disease, hallux rigidus, hepatomegaly, hodgkins disease, hypercalcemia, iatrogenic hypothyroidism, ileostomy status, impetigo, infection/inflammation of internal prosthetic device, implant or graft, intestinal infection due to c. difficile, ischemic stroke, large cell lymphoma, mechanical complication due to other implant and internal device, megaloblastic anemia, multiple sclerosis, nausea and vomiting, nonallopathic lesions nec, noninfectious disorders of lymphatic channels, noninflammatory disorders of vagina, occlusion of cerebral arteries, occlusion of cerebral arteries, with cerebral infarction, orchitis and epididymitis, osteomyelitis, otalgia, other disorders of urethra and urinary tract, otitis media, paralytic ileus, pathological, developmental or recurrent dislocation, peripheral autonomic neuropathy, polyp of female genital organs, posterior pituitary disorders, postinflammatory pulmonary fibrosis, postoperative infection, psychogenic and somatoform disorders, secondary malignancy of lymph nodes, somatoform disorder, sprains and strains, stress incontinence, female, subjective visual disturbances, sulfonamides, symptoms associated with female genital organs, symptoms involving urinary system, temporomandibular joint disorder nos, temporomandibular joint disorders, torsion dystonia, type 1 diabetes, umbilical hernia, unspecified osteomyelitis, urethral stricture (not specified as infectious), varicose veins