rs1682828 chr3:10739054 T>C
- Sequence
agccttccggtgccagctctgcag[T/C]gatggcgccccctggtgtccaatg
- ASB in cell types
- erythroid cells BCBL-1 (B-cell lymphoma) HeLa Kyoto (cervical adenocarcinoma) keratinocytes
- ASB for transcription factors
- SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | 1.22 | -0.37 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1