rs16856586 chr3:171718934 G>A
- Sequence
tgttctaaaccatgtgagattacc[G/A]tctgttttaaaaagatacctcctg
- ASB in cell types
- CD34+ bone marrow cell-derived erythroid progenitors
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 1.90 | n/a | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol, prop taste detection threshold, refractive error, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Lung, Muscle_Skeletal, Nerve_Tibial, Spleen, Thyroid