rs16857668 chr2:11582984 G>A
- Sequence
actggcatttggtgctgggacaga[G/A]cgggcaggatgcacaatgtcccgc
- ASB in cell types
- HepG2 (hepatoblastoma) CD34+ stem cells-derived erythroblasts epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.59 | -0.15 | 1.98 | |||
| CD34+ stem cells-derived erythroblasts | 1.81 | -1.56 | 2.00 | |||
| epidermal keratinocytes | 1.61 | n/a | 2.00 |
Items per page:
1 – 3 of 3