rs16861124 chr3:186753239 T>C
- Sequence
agtgagtaaggattctttgtgaac[T/C]tggagcgctggtagagtgcttttc
- ASB in cell types
- foreskin keratinocyte epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.43 | -2.19 | 2.00 | |||
| epithelial cell of prostate | 1.10 | -1.00 | 1.00 |
Items per page:
1 – 2 of 2