rs16864367 chr3:152516377 G>A
- Sequence
catgtcttgcaacagctctcatgg[G/A]accaccaacaccaccagccagata
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- MEF2B_HUMAN IKZF2_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | 2.61 | n/a | 1.33 | n/a | No Hit | |||
| IKZF2_HUMAN | 1.93 | -1.74 | 1.33 | n/a | n/a | |||
| IKZF1_HUMAN | 1.51 | -1.27 | 1.33 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, rheumatoid arthritis, stabilized warfarin dose, total cholesterol, variant creutzfeldt-jakob disease