rs16866411 chr2:7672266 C>A
- Sequence
atcctgccacctggtggctgcatc[C/A]ctaaattgcaagggcaggtctgtt
- ASB in cell types
- CD34+ stem cells-derived erythroblasts
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.56 | 0.33 | 1.81 | n/a | No Hit |
Items per page:
1 – 1 of 1