rs168944 chr16:21567594 T>C
- Sequence
agcaatcctcccacctcagccccc[T/C]gcgtagctgggactgcagctgagc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) HCT-116 (colon carcinoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.59 | -0.17 | 2.01 | |||
| HEK293 (embryonic kidney) | 0.43 | -0.04 | 1.91 | |||
| HCT-116 (colon carcinoma) | -1.38 | 1.31 | 1.00 | |||
| GM12878 (female B-cells) | 0.79 | 0.18 | 1.31 |
Items per page:
1 – 4 of 4