rs1693956 chr16:86242366 A>G
- Sequence
aggctctcacacccatgctctgac[A/G]cacacacacattcagaaacccccc
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.03 | 0.66 | 1.76 | |||
| HepG2 (hepatoblastoma) | 0.89 | -0.32 | 2.00 |
Items per page:
1 – 2 of 2