rs16950172 chr18:6482887 T>C
- Sequence
ataactcttgctggtgaagaaagc[T/C]gggagaaacatgacgtctgaaggg
- ASB in cell types
- foreskin keratinocyte MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.71 | n/a | 2.50 | |||
| MM1.S (plasma cell myeloma) | -0.83 | 1.19 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP autism, hdl cholesterol change with statins, hypertension (early onset hypertension), ldl cholesterol