rs16953047 chr16:54096258 G>T
- Sequence
acaaagcaatgttagtttccaaat[G/T]ttagctgtagaaagagtgtcattc
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 0.90 | -0.35 | 1.81 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alcohol dependence symptoms, body mass index (bmi), college completion, drotrecogin alfa treatment response to severe sepsis, eye color, neuroticism, simpson-angus scale