rs16972844 chr17:68247947 T>C
- Sequence
gcacgctcaggggcgtggcatggg[T/C]gggtcgtgagttgggcggggccca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) tibial nerve HEK293 (embryonic kidney) upper lobe of left lung
- ASB for transcription factors
- CTCF_HUMAN EP300_HUMAN RFX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.92 | 0.24 | 1.48 | n/a | No Hit | |||
| EP300_HUMAN | 1.92 | -0.03 | 1.25 | n/a | n/a | |||
| RFX1_HUMAN | 1.92 | -2.33 | 1.50 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood