rs170142 chr21:36429792 C>G
- Sequence
ggtgggaggatcatctgagcccag[C/G]gaggttgaggctgcagtgagccga
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.56 | 0.98 | 3.41 | |||
| K562 (myelogenous leukemia) | 0.61 | 0.52 | 1.31 | |||
| GM12878 (female B-cells) | 0.52 | 0.25 | 1.29 |
Items per page:
1 – 3 of 3