rs170492 chr17:38881518 G>C
- Sequence
tacctgctttagcccagcctcctc[G/C]tgttttcttcctgcctctggtctt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | 1.61 | -0.51 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), birth weight, diabetic nephropathy in type 2 diabetes mellitus - end stage renal disease, hdl cholesterol change with statins, height, ldl cholesterol, maternal transmission distortion, paternal transmission distortion, refractive error, transmission distortion, type 2 diabetes, end stage renal disease