rs17090047 chr13:73326094 C>T
- Sequence
acaatcatttacctttatgcaagg[C/T]gcttttgccctacagtctcatgtg
- ASB in cell types
- HT29 (colon adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HT29 (colon adenocarcinoma) | -1.94 | 1.10 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), hdl cholesterol, systolic blood pressure (sbp), triglycerides change with statins