rs17102928 chr14:24325699 C>T
- Sequence
tcctttagagagaggcacaagctc[C/T]tcacccctaggatcacaaactgag
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.15 | 0.63 | 1.73 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), comorbid depressive syndrome and alcohol dependence, hdl cholesterol change with statins, prop taste detection threshold, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Small_Intestine_Terminal_Ileum, Whole_Blood