rs17140052 chr1:43058928 T>C
- Sequence
gactctgtatgtcctcgatctcat[T/C]ctcaatgggctgccatttggctgg
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
- ASB for transcription factors
- PRD10_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRD10_HUMAN | 2.26 | 0.07 | 1.67 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Cells_Cultured_fibroblasts, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis