rs17170908 chr7:37182270 C>T
- Sequence
taacatcggtagagttttatacac[C/T]ggcagatacggtagggcagattct
- ASB in cell types
- H929 (plasma cell myeloma) hepatocytes GM12878 (female B-cells) B-cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | -1.77 | 1.56 | 1.33 | |||
| hepatocytes | -0.81 | 1.23 | 1.11 | |||
| GM12878 (female B-cells) | 0.66 | 0.37 | 1.32 | |||
| B-cells | 2.00 | n/a | 2.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, chronic kidney disease, serum creatinine, triglycerides change with statins