rs171854 chr19:58155435 C>T
- Sequence
gtgattcactttccagaggcccct[C/T]agtgccccgacgctggcccggagg
- ASB in cell types
- foreskin keratinocyte GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.03 | n/a | 2.50 | |||
| GM12878 (female B-cells) | -0.18 | 0.83 | 1.17 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), cystatin c in serum, hdl cholesterol, systolic blood pressure (sbp), total cholesterol