rs17195186 chr9:77150776 G>A
- Sequence
atgatcaccctttcaaaatgataa[G/A]tcaggtctaaaatggattaacctt
- ASB in cell types
- GM23338
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23338 | -2.17 | 1.99 | 1.33 |
Items per page:
1 – 1 of 1