rs1726427 chr12:78140453 A>G
- Sequence
tgacttgcacaggagttgtgtagc[A/G]aaataacggcatactctaagctgc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -1.79 | 1.72 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, chronic rhinosinusitis, maternal transmission distortion, parkinsons disease, schizophrenia, tardive dyskinesia, transmission distortion