rs17271521 chr15:62145164 T>A
- Sequence
gtctatttaatatccagtcttaca[T/A]cagtatttactcttagtatcaaca
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 1.03 | -0.10 | 1.57 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, fasting blood glucose, height, suicide attempts in bipolar disorder (substance abuse/dependence)