rs172787 chr16:3183737 C>A
- Sequence
tgacaccccgccacatacattact[C/A]cccgcaataccatgcaattttaag
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.19 | 0.81 | 2.01 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.52 | 0.78 | 2.14 |
Items per page:
1 – 2 of 2