rs1729168 chr8:13372663 T>C
- Sequence
agcgctaaactatttcctcatctt[T/C]gtgagtaaaaaggaacacgtcatt
- ASB in cell types
- HepG2 (hepatoblastoma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.05 | -0.35 | 1.39 | |||
| A549 (lung carcinoma) | 0.50 | 0.00 | 1.91 |
Items per page:
1 – 2 of 2