rs17301028 chr11:103109595 C>T
- Sequence
aatcatggcgaacgggactgcgga[C/T]gttcggaagctcttcatcttcact
- ASB in cell types
- HEK293T (embryonic kidney) macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293T (embryonic kidney) | 0.92 | -0.35 | 2.00 | |||
| macrophages | 1.51 | -1.08 | 3.00 |
Items per page:
1 – 2 of 2