rs17312483 chr3:63351306 G>A
- Sequence
gtaacaggacatttgacattccct[G/A]cttaatgtgtttgacagtttgagt
- ASB in cell types
- H929 (plasma cell myeloma) GM12878 (female B-cells) epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 1.34 | -1.63 | 1.33 | |||
| GM12878 (female B-cells) | 0.07 | 1.38 | 1.22 | |||
| epidermal keratinocytes | 1.61 | -0.45 | 2.00 |
Items per page:
1 – 3 of 3