rs17349743 chr6:150892075 T>C
- Sequence
gaaacgtgaacctgtgtgcgtttt[T/C]agcagtcaccacatggtggcagcc
- ASB in cell types
- erythroid cells CD34+ stem cells-derived erythroblasts B-cells heart left ventricle
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 2.61 | n/a | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | n/a | 2.89 | 2.50 | |||
| B-cells | 2.05 | -1.88 | 2.00 | |||
| heart left ventricle | 0.75 | -0.75 | 1.00 | |||
| GM12878 (female B-cells) | 0.51 | 0.51 | 1.36 |
Items per page:
1 – 5 of 5