rs17352536 chr8:74576790 C>G
- Sequence
ttctcatagaacccatgaacacaa[C/G]ttagcaacacaactcatatggcct
- ASB in cell types
- LHSAR (prostate epithelial cells) LNCaP C4-2B (prostate carcinoma) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LHSAR (prostate epithelial cells) | 1.46 | -0.71 | 1.50 | |||
| LNCaP C4-2B (prostate carcinoma) | -0.72 | 1.01 | 1.00 | |||
| T47D (invasive ductal carcinoma) | 0.70 | 0.12 | 1.54 |
Items per page:
1 – 3 of 3