rs17356301 chr2:5366141 T>C
- Sequence
agtgatttcctaccctgcgctcgg[T/C]agacacgtttaaatcgcctcacat
- ASB in cell types
- foreskin keratinocyte upper lobe of left lung retinoblastoma xenograft
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -0.61 | 1.64 | 1.44 | |||
| upper lobe of left lung | -1.17 | 1.54 | 1.33 | |||
| retinoblastoma xenograft | 1.87 | -1.70 | 2.00 |
Items per page:
1 – 3 of 3