rs17377415 chr2:6249765 G>A
- Sequence
tacttttccatctccttctttagg[G/A]caacatggcattcttgtggcaaac
- ASB in cell types
- neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.32 | 0.99 | 1.27 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, hdl cholesterol change with statins, parkinsons disease, sporadic creutzfeldt-jakob disease, total cholesterol change with statins