rs173910 chrX:120475718 C>T
- Sequence
tttattttattttattttatttta[C/T]tttatttttattttcttttttttt
- ASB in cell types
- HEK293 (embryonic kidney) neural progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.12 | -0.65 | 1.82 | |||
| neural progenitors | 1.99 | -1.91 | 1.50 |
Items per page:
1 – 2 of 2