rs1740693 chr14:93044299 C>G
- Sequence
tgtgtgggccaaacagattgcatg[C/G]aggcccaggtatatctgagtcacc
- ASB in cell types
- HEK293 (embryonic kidney) HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.31 | 0.69 | 1.89 | |||
| HCT-116 (colon carcinoma) | 1.25 | -0.40 | 1.11 |
Items per page:
1 – 2 of 2