rs17411738 chr8:28203055 T>G
- Sequence
acccgaggccaggagactgcagct[T/G]agcccacctttcccgtggtttatt
- ASB in cell types
- coronary artery smooth muscle
- ASB for transcription factors
- JUN_HUMAN JUND_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 1.92 | -1.95 | 1.33 | n/a | No Hit | |||
| JUND_HUMAN | 1.60 | -1.84 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, body mass index (bmi), fasting blood glucose, hdl cholesterol, obesity with early age of onset (age >2), refractive error