rs17416046 chr8:4542065 C>T
- Sequence
cctgaagtccccgtgtgcaatggg[C/T]gccctctagcttcttaccaagtga
- ASB in cell types
- thyroid gland stomach
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.10 | -1.13 | 1.33 | -0.34 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), age at death with kuru exposure, diastolic blood pressure (dbp), ldl cholesterol, systolic blood pressure (sbp), tetrology of fallot, total cholesterol