rs17439489 chr1:36224998 A>G
- Sequence
ggtggccaaaaacgggatagtcca[A/G]atttgtctcctacgggaatattag
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) HEK293T (embryonic kidney)
- ASB for transcription factors
- KDM1A_HUMAN SP3_HUMAN PF21A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM1A_HUMAN | -1.19 | 1.70 | 1.33 | n/a | n/a | |||
| SP3_HUMAN | n/a | 2.07 | 2.00 | n/a | No Hit | |||
| PF21A_HUMAN | -2.15 | 1.97 | 1.33 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood